The process of biological nitrogen deletion shortcut (SBNR) requires less aeration and external carbon due to the oxidation of ammonia to nitrite and direct denitrification to nitrogen gas for biological nitrogen removal process. However, this process produces poor waste containing NH4 +, because the system has to maintain a high free ammonia (FA, NH3) concentrations.
To overcome this drawback, in this study, solid time of retention (SRT) and dissolved oxygen (DO) concentrations are controlled to achieve the removal rate of ammonia is high and the accumulation of nitrite in the process of sequencing batch reactor (SBR), which can remove nitrogen from water waste the desired concentration and delivers high inhibition of free ammonia and continuous shock loading.
When enough DO supplied, nitrite does not stack with SRT 20 days, but the wash-out of the oxidation of nitrite in short SRT result in the accumulation of high nitrite. When DO act as a limitation, nitrite accumulation SRTs altogether. This suggests that the accumulation of nitrite is more strongly influenced by SRT and DO concentration than the inhibition of the FA. Also, as nitrite accumulated during SRT 10 days without DO concentration, accumulation was more strongly influenced by SRT than the DO concentration.
Profiles that transcriptome of individual cells with single-cell RNA sequencing (scRNA-seq) has been widely applied to provide a detailed molecular characterization of cellular heterogeneity in cell populations. Although the latest technological advances of scRNA-seq, technical variability of gene expression in scRNA-seq is still much higher than in a large number of RNA-seq. Accounting technical variability because it is a prerequisite for true single-cell analyzes data.
This chapter describes the computational pipeline for detecting highly variable gene variability cells showed a higher than expected by technical noise. Basic pipe using scater and scran R / package Bioconductor including deconvolution-based normalization, the mean-variance trend fitting, testing for zero biological variability, and visualization with highly variable genes.
TSHB siRNA |
20-abx938290 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TSHB siRNA |
20-abx938291 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TSHB Rabbit pAb |
A14523-100ul |
Abclonal |
100 ul |
EUR 308.00 |
TSHB Rabbit pAb |
A14523-200ul |
Abclonal |
200 ul |
EUR 459.00 |
TSHB Rabbit pAb |
A14523-20ul |
Abclonal |
20 ul |
EUR 183.00 |
TSHB Rabbit pAb |
A14523-50ul |
Abclonal |
50 ul |
EUR 223.00 |
TSHB Conjugated Antibody |
C39176 |
SAB |
100ul |
EUR 397.00 |
TSHB cloning plasmid |
CSB-CL025130HU-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 417
- Sequence: atgactgctctctttctgatgtccatgctttttggccttgcatgtgggcaagcgatgtctttttgtattccaactgagtatacaatgcacatcgaaaggagagagtgtgcttattgcctaaccatcaacaccaccatctgtgctggatattgtatgacacgggatatcaatggcaa
- Show more
|
Description: A cloning plasmid for the TSHB gene. |
TSHB Rabbit pAb |
A6780-100ul |
Abclonal |
100 ul |
EUR 308.00 |
TSHB Rabbit pAb |
A6780-200ul |
Abclonal |
200 ul |
EUR 459.00 |
TSHB Rabbit pAb |
A6780-20ul |
Abclonal |
20 ul |
EUR 183.00 |
TSHB Rabbit pAb |
A6780-50ul |
Abclonal |
50 ul |
EUR 223.00 |
TSHB Polyclonal Antibody |
A50684 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
TSHB Polyclonal Antibody |
ABP60782-003ml |
Abbkine |
0.03ml |
EUR 158.00 |
- Immunogen information: Synthesized peptide derived from part region of human TSHB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein |
TSHB Polyclonal Antibody |
ABP60782-01ml |
Abbkine |
0.1ml |
EUR 289.00 |
- Immunogen information: Synthesized peptide derived from part region of human TSHB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein |
TSHB Polyclonal Antibody |
ABP60782-02ml |
Abbkine |
0.2ml |
EUR 414.00 |
- Immunogen information: Synthesized peptide derived from part region of human TSHB protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein |
TSHB Polyclonal Antibody |
ES11163-100ul |
ELK Biotech |
100ul |
EUR 279.00 |
Description: A Rabbit Polyclonal antibody against TSHB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TSHB Polyclonal Antibody |
ES11163-50ul |
ELK Biotech |
50ul |
EUR 207.00 |
Description: A Rabbit Polyclonal antibody against TSHB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Recombinant Rat Tshb |
P2468 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: P04652
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for Rat Tshb |
Anti-TSHB antibody |
STJ28863 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants. |
Anti-TSHB antibody |
STJ116734 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants. |
Anti-TSHB antibody |
STJ400191 |
St John's Laboratory |
1 mg |
EUR 446.00 |
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone. |
Anti-TSHB antibody |
STJ400193 |
St John's Laboratory |
1 mg |
EUR 446.00 |
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone. |
Anti-TSHB antibody |
STJ400194 |
St John's Laboratory |
1 mg |
EUR 446.00 |
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone. |
Anti-TSHB antibody |
STJ400195 |
St John's Laboratory |
1 mg |
EUR 446.00 |
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone. |
Anti-TSHB antibody |
STJ400196 |
St John's Laboratory |
1 mg |
EUR 446.00 |
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone. |
Anti-TSHB antibody |
STJ400197 |
St John's Laboratory |
1 mg |
EUR 424.00 |
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone. |
Anti-TSHB antibody |
STJ192321 |
St John's Laboratory |
200 µl |
EUR 197.00 |
Description: Unconjugated Rabbit polyclonal to TSHB |
TSHB Antibody, HRP conjugated |
1-CSB-PA11769B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TSHB Antibody, FITC conjugated |
1-CSB-PA11769C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TSHB Antibody, Biotin conjugated |
1-CSB-PA11769D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Polyclonal TSHB Antibody (Center) |
APR10580G |
Leading Biology |
0.1ml |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSHB (Center). This antibody is tested and proven to work in the following applications: |
TSHB protein (His tag) |
80R-3560 |
Fitzgerald |
20 ug |
EUR 327.00 |
Description: Purified recombinant TSHB protein (His tag) |
Rat TSHB shRNA Plasmid |
20-abx985197 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TSHB shRNA Plasmid |
20-abx954956 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TSHB Human Recombinant Protein |
PROTP01222 |
BosterBio |
Regular: 10ug |
EUR 317.00 |
Description: TSHB Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 141 amino acids (21-138 a.a) and having a molecular mass of 15.9kDa. |
TSHB Recombinant Protein (Rat) |
RP234968 |
ABM |
100 ug |
Ask for price |
TSHB Recombinant Protein (Human) |
RP033139 |
ABM |
100 ug |
Ask for price |
TSHB Recombinant Protein (Mouse) |
RP181703 |
ABM |
100 ug |
Ask for price |
TSHB Recombinant Protein (Mouse) |
RP181706 |
ABM |
100 ug |
Ask for price |
TSHB Recombinant Protein (Mouse) |
RP181709 |
ABM |
100 ug |
Ask for price |
Mouse TSHB ELISA Kit |
STJ150033 |
St John's Laboratory |
1 kit |
EUR 412.00 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in Mouse serum, plasma and other biological fluids |
Rat TSHB ELISA Kit |
STJ150193 |
St John's Laboratory |
1 kit |
EUR 412.00 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in Rat serum, plasma and other biological fluids |
Human TSHB ELISA Kit |
STJ150216 |
St John's Laboratory |
1 kit |
EUR 412.00 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in human serum, plasma and other biological fluids |
Human Thyrotropin subunit beta (TSHB) |
1-CSB-EP025130HU |
Cusabio |
- EUR 380.00
- EUR 214.00
- EUR 1309.00
- EUR 560.00
- EUR 873.00
- EUR 262.00
|
|
- MW: 28.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Thyrotropin subunit beta(TSHB) expressed in E.coli |
Rat Thyrotropin subunit beta (Tshb) |
1-CSB-EP025130RA |
Cusabio |
- EUR 505.00
- EUR 265.00
- EUR 1827.00
- EUR 766.00
- EUR 1218.00
- EUR 335.00
|
|
- MW: 19.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in E.coli |
Monoclonal TSHB Antibody, Clone: 1D12G1 |
APR10579G |
Leading Biology |
0.1ml |
EUR 528.00 |
Description: A Monoclonal antibody against Human TSHB. The antibodies are raised in Mouse and are from clone 1D12G1. This antibody is applicable in WB and IHC, FC, ICC, E |
Rat Thyrotropin subunit beta (Tshb) |
1-CSB-YP025130RA |
Cusabio |
- EUR 586.00
- EUR 299.00
- EUR 2172.00
- EUR 900.00
- EUR 1442.00
- EUR 382.00
|
|
- MW: 16.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in Yeast |
Thyrotropin Subunit Beta (TSHB) Antibody |
20-abx005202 |
Abbexa |
- EUR 411.00
- EUR 592.00
- EUR 182.00
- EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Thyrotropin Subunit Beta (TSHB) Antibody |
abx224242-100ug |
Abbexa |
100 ug |
EUR 411.00 |
- Shipped within 5-10 working days.
|
Thyrotropin Subunit Beta (TSHb) Antibody |
20-abx103378 |
Abbexa |
- EUR 453.00
- EUR 133.00
- EUR 1302.00
- EUR 620.00
- EUR 342.00
|
|
- Shipped within 5-12 working days.
|
Thyrotropin Subunit Beta (TSHB) Antibody |
abx034029-400ul |
Abbexa |
400 ul |
EUR 523.00 |
- Shipped within 5-10 working days.
|
Thyrotropin Subunit Beta (TSHB) Antibody |
abx034029-80l |
Abbexa |
80 µl |
EUR 286.00 |
- Shipped within 5-10 working days.
|
Thyrotropin Subunit Beta (TSHB) Protein |
20-abx263265 |
Abbexa |
- EUR 1609.00
- EUR 328.00
- EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Thyrotropin Subunit Beta (TSHB) Antibody |
20-abx306505 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Rat Thyrotropin subunit beta (Tshb) |
1-CSB-BP025130RA |
Cusabio |
- EUR 840.00
- EUR 332.00
- EUR 2170.00
- EUR 1135.00
- EUR 1579.00
- EUR 470.00
|
|
- MW: 16.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in Baculovirus |
TSHB Polyclonal Antibody, HRP Conjugated |
A50685 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
TSHB Polyclonal Antibody, FITC Conjugated |
A50686 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
TSHB Polyclonal Antibody, Biotin Conjugated |
A50687 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Tshb ORF Vector (Rat) (pORF) |
ORF078324 |
ABM |
1.0 ug DNA |
EUR 506.00 |
TSHB ORF Vector (Human) (pORF) |
ORF011047 |
ABM |
1.0 ug DNA |
EUR 95.00 |
Tshb ORF Vector (Mouse) (pORF) |
ORF060569 |
ABM |
1.0 ug DNA |
EUR 506.00 |
Tshb ORF Vector (Mouse) (pORF) |
ORF060570 |
ABM |
1.0 ug DNA |
EUR 506.00 |
Tshb ORF Vector (Mouse) (pORF) |
ORF060571 |
ABM |
1.0 ug DNA |
EUR 506.00 |
TSHB ELISA Kit (Mouse) (OKCD00118) |
OKCD00118 |
Aviva Systems Biology |
96 Wells |
EUR 857.00 |
Description: Description of target: Indispensable for the control of thyroid structure and metabolism.By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 5.9 pg/mL |
TSHB ELISA Kit (Chicken) (OKEH07396) |
OKEH07396 |
Aviva Systems Biology |
96 Wells |
EUR 609.00 |
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086ng/mL |
TSHB ELISA Kit (Pig) (OKEH07397) |
OKEH07397 |
Aviva Systems Biology |
96 Wells |
EUR 609.00 |
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
TSHB ELISA Kit (Porcine) (OKEI00649) |
OKEI00649 |
Aviva Systems Biology |
96 Wells |
EUR 741.00 |
Description: Description of target: Indispensable for the control of thyroid structure and metabolism. ;Species reactivity: Porcine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.225μIU/mL |
TSHB ELISA Kit (Bovine) (OKEH03756) |
OKEH03756 |
Aviva Systems Biology |
96 Wells |
EUR 414.00 |
Description: Description of target: ;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL |
TSHB ELISA Kit (Dog) (OKEH03757) |
OKEH03757 |
Aviva Systems Biology |
96 Wells |
EUR 414.00 |
Description: Description of target: ;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.27mIU/mL |
Tshb ELISA Kit (Rat) (OKEH04496) |
OKEH04496 |
Aviva Systems Biology |
96 Wells |
EUR 414.00 |
Description: Description of target: Mutation of the human homolog is a rare cause of hereditary hypothyrodism.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.156mIU/mL |
Thyroid Stimulating Hormone Beta (TSHb) Antibody |
20-abx103377 |
Abbexa |
- EUR 439.00
- EUR 133.00
- EUR 1233.00
- EUR 592.00
- EUR 328.00
|
|
- Shipped within 5-7 working days.
|
Thyroid Stimulating Hormone Beta (TSHb) Antibody |
20-abx104915 |
Abbexa |
- EUR 328.00
- EUR 133.00
- EUR 913.00
- EUR 467.00
- EUR 286.00
|
|
- Shipped within 5-7 working days.
|
Thyroid Stimulating Hormone Beta (TSHb) Antibody |
20-abx174792 |
Abbexa |
- EUR 342.00
- EUR 871.00
- EUR 453.00
- EUR 154.00
- EUR 272.00
|
|
- Shipped within 5-7 working days.
|
Thyroid Stimulating Hormone Beta (TSHb) Antibody |
abx239835-100ug |
Abbexa |
100 ug |
EUR 481.00 |
- Shipped within 5-12 working days.
|
Thyrotropin Subunit Beta (TSHB) Antibody (HRP) |
20-abx306506 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Thyrotropin Subunit Beta (TSHB) Antibody (FITC) |
20-abx306507 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Thyrotropin Subunit Beta (TSHB) Antibody (Biotin) |
20-abx306508 |
Abbexa |
- EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Tshb sgRNA CRISPR Lentivector set (Rat) |
K6928201 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Tshb sgRNA CRISPR Lentivector set (Mouse) |
K4334201 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
TSHB sgRNA CRISPR Lentivector set (Human) |
K2539501 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Recombinant Thyroid Stimulating Hormone Beta (TSHb) |
4-RPD213Ca01 |
Cloud-Clone |
- EUR 512.16
- EUR 240.00
- EUR 1645.60
- EUR 615.20
- EUR 1130.40
- EUR 406.00
- EUR 3964.00
|
|
- Uniprot ID: P54828
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 43.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Dog Thyroid Stimulating Hormone Beta expressed in: E.coli |
Recombinant Thyroid Stimulating Hormone Beta (TSHb) |
4-RPD213Ga01 |
Cloud-Clone |
- EUR 476.32
- EUR 230.00
- EUR 1511.20
- EUR 570.40
- EUR 1040.80
- EUR 382.00
- EUR 3628.00
|
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 18.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Chicken Thyroid Stimulating Hormone Beta expressed in: E.coli |
Recombinant Thyroid Stimulating Hormone Beta (TSHb) |
4-RPD213Mu01 |
Cloud-Clone |
- EUR 476.32
- EUR 230.00
- EUR 1511.20
- EUR 570.40
- EUR 1040.80
- EUR 382.00
- EUR 3628.00
|
|
- Uniprot ID: P12656
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 14.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Thyroid Stimulating Hormone Beta expressed in: E.coli |
Recombinant Thyroid Stimulating Hormone Beta (TSHb) |
4-RPD213Ra01 |
Cloud-Clone |
- EUR 485.28
- EUR 233.00
- EUR 1544.80
- EUR 581.60
- EUR 1063.20
- EUR 388.00
- EUR 3712.00
|
|
- Uniprot ID: P04652
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 16.6kDa
- Isoelectric Point: 7.5
|
Description: Recombinant Rat Thyroid Stimulating Hormone Beta expressed in: E.coli |
Chicken TSHB/ Thyrotropin subunit beta ELISA Kit |
E0085Ch |
Sunlong |
1 Kit |
EUR 494.00 |
Dog TSHB/ Thyrotropin subunit beta ELISA Kit |
E0106Do |
Sunlong |
1 Kit |
EUR 494.00 |
Rat Thyrotropin subunit β(TSHB) ELISA kit |
E02T0738-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Thyrotropin subunit β(TSHB) ELISA kit |
E02T0738-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Thyrotropin subunit β(TSHB) ELISA kit |
E02T0738-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Thyrotropin subunit β(TSHB) ELISA kit |
E04T0738-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Thyrotropin subunit β(TSHB) ELISA kit |
E04T0738-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Thyrotropin subunit β(TSHB) ELISA kit |
E04T0738-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thyrotropin subunit β(TSHB) ELISA kit |
E01T0738-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thyrotropin subunit β(TSHB) ELISA kit |
E01T0738-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thyrotropin subunit β(TSHB) ELISA kit |
E01T0738-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Bovine TSHB/ Thyrotropin subunit beta ELISA Kit |
E0277Bo |
Sunlong |
1 Kit |
EUR 494.00 |
Mouse Thyrotropin subunit β(TSHB) ELISA kit |
E03T0738-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Thyrotropin subunit β(TSHB) ELISA kit |
E03T0738-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Thyrotropin subunit β(TSHB) ELISA kit |
E03T0738-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Thyroid Stimulating Hormone Beta (TSHb) Protein |
20-abx166338 |
Abbexa |
- EUR 718.00
- EUR 286.00
- EUR 2221.00
- EUR 857.00
- EUR 509.00
|
|
- Shipped within 5-7 working days.
|
Mouse Thyroid Stimulating Hormone Beta (TSHb) Protein |
20-abx069310 |
Abbexa |
- EUR 662.00
- EUR 272.00
- EUR 2040.00
- EUR 787.00
- EUR 481.00
|
|
- Shipped within 5-7 working days.
|
Mouse Thyrotropin subunit beta (TSHB) ELISA Kit |
abx254595-96tests |
Abbexa |
96 tests |
EUR 668.00 |
- Shipped within 5-12 working days.
|
Rat Thyrotropin subunit beta (TSHB) ELISA Kit |
abx255652-96tests |
Abbexa |
96 tests |
EUR 637.00 |
- Shipped within 5-12 working days.
|
Human Thyrotropin subunit beta (TSHB) ELISA Kit |
abx253456-96tests |
Abbexa |
96 tests |
EUR 637.00 |
- Shipped within 5-12 working days.
|
Dog Thyrotropin subunit β(TSHB) ELISA kit |
E08T0738-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Thyrotropin subunit β(TSHB) ELISA kit |
E08T0738-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Thyrotropin subunit β(TSHB) ELISA kit |
E08T0738-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Thyrotropin subunit β(TSHB) ELISA kit |
E07T0738-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Thyrotropin subunit β(TSHB) ELISA kit |
E07T0738-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Thyrotropin subunit β(TSHB) ELISA kit |
E07T0738-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Thyrotropin subunit β(TSHB) ELISA kit |
E09T0738-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Thyrotropin subunit β(TSHB) ELISA kit |
E09T0738-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Thyrotropin subunit β(TSHB) ELISA kit |
E09T0738-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Thyrotropin subunit β(TSHB) ELISA kit |
E06T0738-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Thyrotropin subunit β(TSHB) ELISA kit |
E06T0738-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Thyrotropin subunit β(TSHB) ELISA kit |
E06T0738-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tshb/ Thyrotropin subunit beta ELISA Kit |
E1012Ra |
Sunlong |
1 Kit |
EUR 485.00 |
Mouse Tshb/ Thyrotropin subunit beta ELISA Kit |
E1534Mo |
Sunlong |
1 Kit |
EUR 485.00 |
Human TSHB/ Thyrotropin subunit beta ELISA Kit |
E2599Hu |
Sunlong |
1 Kit |
EUR 485.00 |
Thyroid Stimulating Hormone Beta (TSHb) Antibody (Biotin) |
20-abx271722 |
Abbexa |
- EUR 481.00
- EUR 244.00
- EUR 1414.00
- EUR 662.00
- EUR 356.00
|
|
- Shipped within 5-15 working days.
|
Thyroid Stimulating Hormone Beta (TSHb) Antibody (Biotin) |
20-abx272898 |
Abbexa |
- EUR 467.00
- EUR 244.00
- EUR 1344.00
- EUR 634.00
- EUR 342.00
|
|
- Shipped within 5-15 working days.
|
Chicken Thyroid Stimulating Hormone Beta (TSHb) Protein |
20-abx652214 |
Abbexa |
- EUR 662.00
- EUR 272.00
- EUR 2040.00
- EUR 787.00
- EUR 481.00
|
|
- Shipped within 5-12 working days.
|
Cow Thyrotropin subunit beta (TSHB) ELISA Kit |
abx513012-96tests |
Abbexa |
96 tests |
EUR 911.00 |
- Shipped within 5-12 working days.
|
Chicken Thyrotropin subunit beta (TSHB) ELISA Kit |
abx513013-96tests |
Abbexa |
96 tests |
EUR 911.00 |
- Shipped within 5-12 working days.
|
Dog Thyrotropin subunit beta (TSHB) ELISA Kit |
abx513014-96tests |
Abbexa |
96 tests |
EUR 911.00 |
- Shipped within 5-12 working days.
|
Mouse Thyrotropin subunit beta (TSHB) ELISA Kit |
abx513016-96tests |
Abbexa |
96 tests |
EUR 637.00 |
- Shipped within 5-12 working days.
|
Pig Thyrotropin subunit beta (TSHB) ELISA Kit |
abx513017-96tests |
Abbexa |
96 tests |
EUR 911.00 |
- Shipped within 5-12 working days.
|
Thyroid Stimulating Hormone Beta (TSHb) Antibody (FITC) |
20-abx273890 |
Abbexa |
- EUR 495.00
- EUR 258.00
- EUR 1455.00
- EUR 676.00
- EUR 398.00
|
|
- Shipped within 5-15 working days.
|
Rat Tshb(Thyrotropin subunit beta) ELISA Kit |
ER0078 |
FN Test |
96T |
EUR 567.60 |
- Detection range: 0.156-10uIU/ml
- Uniprot ID: P04652
- Alias: Tshb(Thyrotropin subunit beta)/Thyrotropin beta/thyroid stimulating hormone, beta/thyroid-stimulating hormone subunit beta/thyrotropin beta chain/thyrotropin beta subunit/TSH-B/TSH-BETA
|
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.094uIU/ml |
Tshb sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6928202 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Tshb sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6928203 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Tshb sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6928204 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Tshb sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4334202 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Tshb sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4334203 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Tshb sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4334204 |
ABM |
1.0 ug DNA |
EUR 154.00 |
TSHB sgRNA CRISPR Lentivector (Human) (Target 1) |
K2539502 |
ABM |
1.0 ug DNA |
EUR 154.00 |
TSHB sgRNA CRISPR Lentivector (Human) (Target 2) |
K2539503 |
ABM |
1.0 ug DNA |
EUR 154.00 |
TSHB sgRNA CRISPR Lentivector (Human) (Target 3) |
K2539504 |
ABM |
1.0 ug DNA |
EUR 154.00 |
TSHB Protein Vector (Rat) (pPB-C-His) |
PV313294 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Rat) (pPB-N-His) |
PV313295 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Rat) (pPM-C-HA) |
PV313296 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Rat) (pPM-C-His) |
PV313297 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPB-C-His) |
PV242274 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPB-N-His) |
PV242275 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPM-C-HA) |
PV242276 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPM-C-His) |
PV242277 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPB-C-His) |
PV242278 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPB-N-His) |
PV242279 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPM-C-HA) |
PV242280 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPM-C-His) |
PV242281 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPB-C-His) |
PV242282 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPB-N-His) |
PV242283 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPM-C-HA) |
PV242284 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Mouse) (pPM-C-His) |
PV242285 |
ABM |
500 ng |
EUR 603.00 |
TSHB Protein Vector (Human) (pPB-C-His) |
PV044185 |
ABM |
500 ng |
EUR 329.00 |
TSHB Protein Vector (Human) (pPB-N-His) |
PV044186 |
ABM |
500 ng |
EUR 329.00 |
TSHB Protein Vector (Human) (pPM-C-HA) |
PV044187 |
ABM |
500 ng |
EUR 329.00 |
TSHB Protein Vector (Human) (pPM-C-His) |
PV044188 |
ABM |
500 ng |
EUR 329.00 |
Tshb 3'UTR Luciferase Stable Cell Line |
TU121225 |
ABM |
1.0 ml |
Ask for price |
TSHB 3'UTR GFP Stable Cell Line |
TU077294 |
ABM |
1.0 ml |
EUR 1521.00 |
Tshb 3'UTR GFP Stable Cell Line |
TU171225 |
ABM |
1.0 ml |
Ask for price |
Tshb 3'UTR Luciferase Stable Cell Line |
TU222542 |
ABM |
1.0 ml |
Ask for price |
TSHB 3'UTR Luciferase Stable Cell Line |
TU027294 |
ABM |
1.0 ml |
EUR 1521.00 |
Tshb 3'UTR GFP Stable Cell Line |
TU272542 |
ABM |
1.0 ml |
Ask for price |
TSHB ELISA Kit (Human) : 96 Wells (OKEH00458) |
OKEH00458 |
Aviva Systems Biology |
96 Wells |
EUR 557.00 |
Description: Description of target: Indispensable for the control of thyroid structure and metabolism.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.06 ng/mL |
TSHB ELISA Kit (Mouse) : 96 Wells (OKEH00459) |
OKEH00459 |
Aviva Systems Biology |
96 Wells |
EUR 414.00 |
Description: Description of target: Indispensable for the control of thyroid structure and metabolism.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.156mIU/mL |