Evaluation of predominant factor for shortcut biological nitrogen removal in sequencing batch reactor at ambient temperature.

The process of biological nitrogen deletion shortcut (SBNR) requires less aeration and external carbon due to the oxidation of ammonia to nitrite and direct denitrification to nitrogen gas for biological nitrogen removal process. However, this process produces poor waste containing NH4 +, because the system has to maintain a high free ammonia (FA, NH3) concentrations.

To overcome this drawback, in this study, solid time of retention (SRT) and dissolved oxygen (DO) concentrations are controlled to achieve the removal rate of ammonia is high and the accumulation of nitrite in the process of sequencing batch reactor (SBR), which can remove nitrogen from water waste the desired concentration and delivers high inhibition of free ammonia and continuous shock loading.

When enough DO supplied, nitrite does not stack with SRT 20 days, but the wash-out of the oxidation of nitrite in short SRT result in the accumulation of high nitrite. When DO act as a limitation, nitrite accumulation SRTs altogether. This suggests that the accumulation of nitrite is more strongly influenced by SRT and DO concentration than the inhibition of the FA. Also, as nitrite accumulated during SRT 10 days without DO concentration, accumulation was more strongly influenced by SRT than the DO concentration.

Profiles that transcriptome of individual cells with single-cell RNA sequencing (scRNA-seq) has been widely applied to provide a detailed molecular characterization of cellular heterogeneity in cell populations. Although the latest technological advances of scRNA-seq, technical variability of gene expression in scRNA-seq is still much higher than in a large number of RNA-seq. Accounting technical variability because it is a prerequisite for true single-cell analyzes data.

This chapter describes the computational pipeline for detecting highly variable gene variability cells showed a higher than expected by technical noise. Basic pipe using scater and scran R / package Bioconductor including deconvolution-based normalization, the mean-variance trend fitting, testing for zero biological variability, and visualization with highly variable genes.

TSHB siRNA
20-abx938291	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TSHB Antibody
1-CSB-PA11769A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is Unconjugated. Tested in the following application: ELISA

TSHB Conjugated Antibody
C39176	SAB	100ul	EUR 397.00

TSHB Polyclonal Antibody
A50684	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

TSHB Polyclonal Antibody
ABP60782-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human TSHB protein Applications tips:
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein

TSHB Polyclonal Antibody
ABP60782-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human TSHB protein Applications tips:
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein

TSHB Polyclonal Antibody
ABP60782-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human TSHB protein Applications tips:
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein

TSHB cloning plasmid
CSB-CL025130HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 417 Sequence: atgactgctctctttctgatgtccatgctttttggccttgcatgtgggcaagcgatgtctttttgtattccaactgagtatacaatgcacatcgaaaggagagagtgtgcttattgcctaaccatcaacaccaccatctgtgctggatattgtatgacacgggatatcaatggcaa Show more
Description: A cloning plasmid for the TSHB gene.

TSHB Polyclonal Antibody
E-AB-40009-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3. Purified by: Affinity purification Background: Indispensable for the control of thyroid structure and metabolism.
Description: Rabbit antibody against Mouse,Rat TSHB for WB,IHC applications.

TSHB Polyclonal Antibody
E-AB-40009-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3. Purified by: Affinity purification Background: Indispensable for the control of thyroid structure and metabolism.
Description: Rabbit antibody against Mouse,Rat TSHB for WB,IHC applications.

TSHB Polyclonal Antibody
E-AB-40009-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3. Purified by: Affinity purification Background: Indispensable for the control of thyroid structure and metabolism.
Description: Rabbit antibody against Mouse,Rat TSHB for WB,IHC applications.

TSHB Polyclonal Antibody
ES11163-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against TSHB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TSHB Polyclonal Antibody
ES11163-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against TSHB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Recombinant Rat Tshb
P2468	FN Test	100ug	Ask for price
Uniprot ID: P04652 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for Rat Tshb

TSHB Rabbit pAb
A14523-100ul	Abclonal	100 ul	EUR 308.00

TSHB Rabbit pAb
A14523-200ul	Abclonal	200 ul	EUR 459.00

TSHB Rabbit pAb
A14523-20ul	Abclonal	20 ul	EUR 183.00

TSHB Rabbit pAb
A14523-50ul	Abclonal	50 ul	EUR 223.00

TSHB Rabbit pAb
A6780-100ul	Abclonal	100 ul	EUR 308.00

TSHB Rabbit pAb
A6780-200ul	Abclonal	200 ul	EUR 459.00

TSHB Rabbit pAb
A6780-20ul	Abclonal	20 ul	EUR 183.00

TSHB Rabbit pAb
A6780-50ul	Abclonal	50 ul	EUR 223.00

Anti-TSHB antibody
STJ192321	St John's Laboratory	200 µl	EUR 197.00
Description: Unconjugated Rabbit polyclonal to TSHB

Anti-TSHB antibody
STJ116734	St John's Laboratory	100 µl	EUR 277.00
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants.

Anti-TSHB antibody
STJ28863	St John's Laboratory	100 µl	EUR 277.00
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants.

Anti-TSHB antibody
STJ400191	St John's Laboratory	1 mg	EUR 446.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody
STJ400193	St John's Laboratory	1 mg	EUR 446.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody
STJ400194	St John's Laboratory	1 mg	EUR 446.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody
STJ400195	St John's Laboratory	1 mg	EUR 446.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody
STJ400196	St John's Laboratory	1 mg	EUR 446.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody
STJ400197	St John's Laboratory	1 mg	EUR 424.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB Antibody
STJ503423	St John's Laboratory	100 µg	EUR 476.00

Anti-TSHB Antibody
STJ503424	St John's Laboratory	100 µg	EUR 476.00

Rat TSHB shRNA Plasmid
20-abx985197	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TSHB protein (His tag)
80R-3560	Fitzgerald	20 ug	EUR 327.00
Description: Purified recombinant TSHB protein (His tag)

Human TSHB shRNA Plasmid
20-abx954956	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TSHB Antibody, HRP conjugated
1-CSB-PA11769B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TSHB Antibody, FITC conjugated
1-CSB-PA11769C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TSHB Antibody, Biotin conjugated
1-CSB-PA11769D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TSHB ELISA KIT|Human
EF000321	Lifescience Market	96 Tests	EUR 689.00

Human TSHB ELISA Kit
ELA-E0463h	Lifescience Market	96 Tests	EUR 824.00

TSHB Human Recombinant Protein
PROTP01222	BosterBio	Regular: 10ug	EUR 317.00
Description: TSHB Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 141 amino acids (21-138 a.a) and having a molecular mass of 15.9kDa.

TSHB Recombinant Protein (Mouse)
RP181703	ABM	100 ug	Ask for price

TSHB Recombinant Protein (Mouse)
RP181706	ABM	100 ug	Ask for price

TSHB Recombinant Protein (Mouse)
RP181709	ABM	100 ug	Ask for price

TSHB Recombinant Protein (Rat)
RP234968	ABM	100 ug	Ask for price

TSHB Recombinant Protein (Human)
RP033139	ABM	100 ug	Ask for price

Polyclonal TSHB Antibody (Center)
APR10580G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSHB (Center). This antibody is tested and proven to work in the following applications:

Mouse TSHB ELISA Kit
STJ150033	St John's Laboratory	1 kit	EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in Mouse serum, plasma and other biological fluids

Rat TSHB ELISA Kit
STJ150193	St John's Laboratory	1 kit	EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in Rat serum, plasma and other biological fluids

Human TSHB ELISA Kit
STJ150216	St John's Laboratory	1 kit	EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in human serum, plasma and other biological fluids

Anti-TSHB Antibody (Biotin)
STJ503425	St John's Laboratory	100 µg	EUR 586.00

Anti-TSHB Antibody (FITC)
STJ503426	St John's Laboratory	100 µg	EUR 586.00

Anti-TSHB Antibody (Biotin)
STJ503427	St John's Laboratory	100 µg	EUR 586.00

Anti-TSHB Antibody (FITC)
STJ503428	St John's Laboratory	100 µg	EUR 586.00

Rat Thyrotropin subunit beta (Tshb)
1-CSB-YP025130RA	Cusabio	EUR 586.00 EUR 299.00 EUR 2172.00 EUR 900.00 EUR 1442.00 EUR 382.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 16.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in Yeast

TSHB Polyclonal Antibody, HRP Conjugated
A50685	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TSHB Polyclonal Antibody, FITC Conjugated
A50686	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

TSHB Polyclonal Antibody, Biotin Conjugated
A50687	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Thyrotropin Subunit Beta (TSHB) Antibody
20-abx005202	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody
abx034029-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody
abx034029-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHb) Antibody
20-abx103378	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Rat Thyrotropin subunit beta (Tshb)
1-CSB-BP025130RA	Cusabio	EUR 840.00 EUR 332.00 EUR 2170.00 EUR 1135.00 EUR 1579.00 EUR 470.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 16.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in Baculovirus

Thyrotropin Subunit Beta (TSHB) Antibody
20-abx306505	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Protein
20-abx263265	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody
abx224242-100ug	Abbexa	100 ug	EUR 411.00
Shipped within 5-10 working days.

Human Thyrotropin subunit beta (TSHB)
1-CSB-EP025130HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 28.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Thyrotropin subunit beta(TSHB) expressed in E.coli

Rat Thyrotropin subunit beta (Tshb)
1-CSB-EP025130RA	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 19.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in E.coli

Tshb ORF Vector (Rat) (pORF)
ORF078324	ABM	1.0 ug DNA	EUR 506.00

TSHB ORF Vector (Human) (pORF)
ORF011047	ABM	1.0 ug DNA	EUR 95.00

Tshb ORF Vector (Mouse) (pORF)
ORF060569	ABM	1.0 ug DNA	EUR 506.00

Tshb ORF Vector (Mouse) (pORF)
ORF060570	ABM	1.0 ug DNA	EUR 506.00

Tshb ORF Vector (Mouse) (pORF)
ORF060571	ABM	1.0 ug DNA	EUR 506.00

Monoclonal TSHB Antibody, Clone: 1D12G1
APR10579G	Leading Biology	0.1ml	EUR 528.00
Description: A Monoclonal antibody against Human TSHB. The antibodies are raised in Mouse and are from clone 1D12G1. This antibody is applicable in WB and IHC, FC, ICC, E

Thyroid Stimulating Hormone Beta (TSHb) Antibody
20-abx104915	Abbexa	EUR 328.00 EUR 133.00 EUR 913.00 EUR 467.00 EUR 286.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody
20-abx103377	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

TSHB sgRNA CRISPR Lentivector set (Human)
K2539501	ABM	3 x 1.0 ug	EUR 339.00

Tshb sgRNA CRISPR Lentivector set (Mouse)
K4334201	ABM	3 x 1.0 ug	EUR 339.00

Thyroid Stimulating Hormone Beta (TSHb) Antibody
abx239835-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Thyrotropin Subunit Beta (TSHB) Antibody (HRP)
20-abx306506	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody (FITC)
20-abx306507	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody (Biotin)
20-abx306508	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody
20-abx174792	Abbexa	EUR 342.00 EUR 871.00 EUR 453.00 EUR 154.00 EUR 272.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Recombinant Thyroid Stimulating Hormone Beta (TSHb)
4-RPD213Ca01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P54828 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 43.7kDa Isoelectric Point: Inquire
Description: Recombinant Dog Thyroid Stimulating Hormone Beta expressed in: E.coli

Recombinant Thyroid Stimulating Hormone Beta (TSHb)
4-RPD213Ga01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.7kDa Isoelectric Point: Inquire
Description: Recombinant Chicken Thyroid Stimulating Hormone Beta expressed in: E.coli

Recombinant Thyroid Stimulating Hormone Beta (TSHb)
4-RPD213Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P12656 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 14.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Thyroid Stimulating Hormone Beta expressed in: E.coli

Recombinant Thyroid Stimulating Hormone Beta (TSHb)
4-RPD213Ra01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04652 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.6kDa Isoelectric Point: 7.5
Description: Recombinant Rat Thyroid Stimulating Hormone Beta expressed in: E.coli

Tshb sgRNA CRISPR Lentivector set (Rat)
K6928201	ABM	3 x 1.0 ug	EUR 339.00

TSHB sgRNA CRISPR Lentivector (Human) (Target 1)
K2539502	ABM	1.0 ug DNA	EUR 154.00

TSHB sgRNA CRISPR Lentivector (Human) (Target 2)
K2539503	ABM	1.0 ug DNA	EUR 154.00

TSHB sgRNA CRISPR Lentivector (Human) (Target 3)
K2539504	ABM	1.0 ug DNA	EUR 154.00

Pig Thyrotropin subunit β(TSHB) ELISA kit
E07T0738-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thyrotropin subunit β(TSHB) ELISA kit
E07T0738-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thyrotropin subunit β(TSHB) ELISA kit
E07T0738-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thyrotropin subunit β(TSHB) ELISA kit
E08T0738-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thyrotropin subunit β(TSHB) ELISA kit
E08T0738-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thyrotropin subunit β(TSHB) ELISA kit
E08T0738-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Tshb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4334202	ABM	1.0 ug DNA	EUR 154.00

Tshb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4334203	ABM	1.0 ug DNA	EUR 154.00

Tshb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4334204	ABM	1.0 ug DNA	EUR 154.00

Cow Thyrotropin subunit beta (TSHB) ELISA Kit
abx513012-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Chicken Thyrotropin subunit beta (TSHB) ELISA Kit
abx513013-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Dog Thyrotropin subunit beta (TSHB) ELISA Kit
abx513014-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Mouse Thyrotropin subunit beta (TSHB) ELISA Kit
abx513016-96tests	Abbexa	96 tests	EUR 637.00
Shipped within 5-12 working days.

Pig Thyrotropin subunit beta (TSHB) ELISA Kit
abx513017-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Rat Thyrotropin subunit beta (TSHB) ELISA Kit
abx255652-96tests	Abbexa	96 tests	EUR 637.00
Shipped within 5-12 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody (FITC)
20-abx273890	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody (Biotin)
20-abx271722	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody (Biotin)
20-abx272898	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Dog Thyroid Stimulating Hormone Beta (TSHb) Protein
20-abx166338	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Thyrotropin subunit beta (TSHB) ELISA Kit
abx254595-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Human Thyrotropin subunit beta (TSHB) ELISA Kit
abx253456-96tests	Abbexa	96 tests	EUR 637.00
Shipped within 5-12 working days.

Mouse Thyroid Stimulating Hormone Beta (TSHb) Protein
20-abx069310	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Chicken Thyroid Stimulating Hormone Beta (TSHb) Protein
20-abx652214	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Thyrotropin subunit β(TSHB) ELISA kit
E03T0738-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Thyrotropin subunit β(TSHB) ELISA kit
E03T0738-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Thyrotropin subunit β(TSHB) ELISA kit
E03T0738-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thyrotropin subunit β(TSHB) ELISA kit
E04T0738-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thyrotropin subunit β(TSHB) ELISA kit
E04T0738-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thyrotropin subunit β(TSHB) ELISA kit
E04T0738-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thyrotropin subunit β(TSHB) ELISA kit
E06T0738-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thyrotropin subunit β(TSHB) ELISA kit
E06T0738-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thyrotropin subunit β(TSHB) ELISA kit
E06T0738-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thyrotropin subunit β(TSHB) ELISA kit
E02T0738-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thyrotropin subunit β(TSHB) ELISA kit
E02T0738-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thyrotropin subunit β(TSHB) ELISA kit
E02T0738-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyrotropin subunit β(TSHB) ELISA kit
E01T0738-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyrotropin subunit β(TSHB) ELISA kit
E01T0738-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyrotropin subunit β(TSHB) ELISA kit
E01T0738-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thyrotropin subunit β(TSHB) ELISA kit
E09T0738-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thyrotropin subunit β(TSHB) ELISA kit
E09T0738-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thyrotropin subunit β(TSHB) ELISA kit
E09T0738-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TSHB Protein Vector (Mouse) (pPB-C-His)
PV242274	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Mouse) (pPB-N-His)
PV242275	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-HA)
PV242276	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-His)
PV242277	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Mouse) (pPB-C-His)
PV242278	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Mouse) (pPB-N-His)
PV242279	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-HA)
PV242280	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-His)
PV242281	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Mouse) (pPB-C-His)
PV242282	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Mouse) (pPB-N-His)
PV242283	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-HA)
PV242284	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-His)
PV242285	ABM	500 ng	EUR 603.00

Tshb sgRNA CRISPR Lentivector (Rat) (Target 1)
K6928202	ABM	1.0 ug DNA	EUR 154.00

Tshb sgRNA CRISPR Lentivector (Rat) (Target 2)
K6928203	ABM	1.0 ug DNA	EUR 154.00

Tshb sgRNA CRISPR Lentivector (Rat) (Target 3)
K6928204	ABM	1.0 ug DNA	EUR 154.00

TSHB Protein Vector (Human) (pPB-C-His)
PV044185	ABM	500 ng	EUR 329.00

TSHB Protein Vector (Human) (pPB-N-His)
PV044186	ABM	500 ng	EUR 329.00

TSHB Protein Vector (Human) (pPM-C-HA)
PV044187	ABM	500 ng	EUR 329.00

TSHB Protein Vector (Human) (pPM-C-His)
PV044188	ABM	500 ng	EUR 329.00

Tshb 3'UTR GFP Stable Cell Line
TU171225	ABM	1.0 ml	Ask for price

TSHB Protein Vector (Rat) (pPB-C-His)
PV313294	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Rat) (pPB-N-His)
PV313295	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Rat) (pPM-C-HA)
PV313296	ABM	500 ng	EUR 603.00

TSHB Protein Vector (Rat) (pPM-C-His)
PV313297	ABM	500 ng	EUR 603.00

TSHB 3'UTR Luciferase Stable Cell Line
TU027294	ABM	1.0 ml	EUR 1521.00

TSHB 3'UTR GFP Stable Cell Line
TU077294	ABM	1.0 ml	EUR 1521.00

Tshb 3'UTR Luciferase Stable Cell Line
TU121225	ABM	1.0 ml	Ask for price

Dog TSHB/ Thyrotropin subunit beta ELISA Kit
E0106Do	Sunlong	1 Kit	EUR 494.00

Bovine TSHB/ Thyrotropin subunit beta ELISA Kit
E0277Bo	Sunlong	1 Kit	EUR 494.00

Chicken TSHB/ Thyrotropin subunit beta ELISA Kit
E0085Ch	Sunlong	1 Kit	EUR 494.00

Tshb 3'UTR Luciferase Stable Cell Line
TU222542	ABM	1.0 ml	Ask for price

Tshb 3'UTR GFP Stable Cell Line
TU272542	ABM	1.0 ml	Ask for price

Rat Tshb(Thyrotropin subunit beta) ELISA Kit
ER0078	FN Test	96T	EUR 567.60
Detection range: 0.156-10uIU/ml Uniprot ID: P04652 Alias: Tshb(Thyrotropin subunit beta)/Thyrotropin beta/thyroid stimulating hormone, beta/thyroid-stimulating hormone subunit beta/thyrotropin beta chain/thyrotropin beta subunit/TSH-B/TSH-BETA
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.094uIU/ml

Human TSHB/ Thyrotropin subunit beta ELISA Kit
E2599Hu	Sunlong	1 Kit	EUR 485.00

Rat Tshb/ Thyrotropin subunit beta ELISA Kit
E1012Ra	Sunlong	1 Kit	EUR 485.00

Mouse Tshb/ Thyrotropin subunit beta ELISA Kit
E1534Mo	Sunlong	1 Kit	EUR 485.00

Guinea pig Thyrotropin subunit β(TSHB) ELISA kit
E05T0738-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Thyrotropin subunit β(TSHB) ELISA kit
E05T0738-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Thyrotropin subunit β(TSHB) ELISA kit
E05T0738-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Thyroid Stimulating Hormone Beta (TSHb) Monoclonal Antibody (Mouse)
4-MAD213Mu21	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rat monoclonal antibody against Mouse Thyroid Stimulating Hormone Beta (TSHb)

TSHB Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV678853	ABM	1.0 ug DNA	EUR 514.00

TSHB Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV678857	ABM	1.0 ug DNA	EUR 514.00