Evaluation of predominant factor for shortcut biological nitrogen removal in sequencing batch reactor at ambient temperature.

The process of biological nitrogen deletion shortcut (SBNR) requires less aeration and external carbon due to the oxidation of ammonia to nitrite and direct denitrification to nitrogen gas for biological nitrogen removal process. However, this process produces poor waste containing NH4 +, because the system has to maintain a high free ammonia (FA, NH3) concentrations.

To overcome this drawback, in this study, solid time of retention (SRT) and dissolved oxygen (DO) concentrations are controlled to achieve the removal rate of ammonia is high and the accumulation of nitrite in the process of sequencing batch reactor (SBR), which can remove nitrogen from water waste the desired concentration and delivers high inhibition of free ammonia and continuous shock loading.

When enough DO supplied, nitrite does not stack with SRT 20 days, but the wash-out of the oxidation of nitrite in short SRT result in the accumulation of high nitrite. When DO act as a limitation, nitrite accumulation SRTs altogether. This suggests that the accumulation of nitrite is more strongly influenced by SRT and DO concentration than the inhibition of the FA. Also, as nitrite accumulated during SRT 10 days without DO concentration, accumulation was more strongly influenced by SRT than the DO concentration.

Profiles that transcriptome of individual cells with single-cell RNA sequencing (scRNA-seq) has been widely applied to provide a detailed molecular characterization of cellular heterogeneity in cell populations. Although the latest technological advances of scRNA-seq, technical variability of gene expression in scRNA-seq is still much higher than in a large number of RNA-seq. Accounting technical variability because it is a prerequisite for true single-cell analyzes data.

This chapter describes the computational pipeline for detecting highly variable gene variability cells showed a higher than expected by technical noise. Basic pipe using scater and scran R / package Bioconductor including deconvolution-based normalization, the mean-variance trend fitting, testing for zero biological variability, and visualization with highly variable genes.

TSHB siRNA

20-abx938290
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

TSHB siRNA

20-abx938291
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

TSHB Rabbit pAb

A14523-100ul 100 ul
EUR 308.00

TSHB Rabbit pAb

A14523-200ul 200 ul
EUR 459.00

TSHB Rabbit pAb

A14523-20ul 20 ul
EUR 183.00

TSHB Rabbit pAb

A14523-50ul 50 ul
EUR 223.00

TSHB Conjugated Antibody

C39176 100ul
EUR 397.00

TSHB cloning plasmid

CSB-CL025130HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 417
  • Sequence: atgactgctctctttctgatgtccatgctttttggccttgcatgtgggcaagcgatgtctttttgtattccaactgagtatacaatgcacatcgaaaggagagagtgtgcttattgcctaaccatcaacaccaccatctgtgctggatattgtatgacacgggatatcaatggcaa
  • Show more
Description: A cloning plasmid for the TSHB gene.

TSHB Rabbit pAb

A6780-100ul 100 ul
EUR 308.00

TSHB Rabbit pAb

A6780-200ul 200 ul
EUR 459.00

TSHB Rabbit pAb

A6780-20ul 20 ul
EUR 183.00

TSHB Rabbit pAb

A6780-50ul 50 ul
EUR 223.00

TSHB Polyclonal Antibody

A50684 100 µg
EUR 570.55
Description: Ask the seller for details

TSHB Polyclonal Antibody

ABP60782-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human TSHB protein
  • Applications tips:
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein

TSHB Polyclonal Antibody

ABP60782-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human TSHB protein
  • Applications tips:
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein

TSHB Polyclonal Antibody

ABP60782-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human TSHB protein
  • Applications tips:
Description: A polyclonal antibody for detection of TSHB from Human, Mouse, Rat. This TSHB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHB protein

TSHB Polyclonal Antibody

ES11163-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against TSHB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TSHB Polyclonal Antibody

ES11163-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against TSHB from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Recombinant Rat Tshb

P2468 100ug Ask for price
  • Uniprot ID: P04652
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for Rat Tshb

Anti-TSHB antibody

STJ28863 100 µl
EUR 277.00
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants.

Anti-TSHB antibody

STJ116734 100 µl
EUR 277.00
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants.

Anti-TSHB antibody

STJ400191 1 mg
EUR 446.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ400193 1 mg
EUR 446.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ400194 1 mg
EUR 446.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ400195 1 mg
EUR 446.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ400196 1 mg
EUR 446.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ400197 1 mg
EUR 424.00
Description: Thyroid-stimulating hormone (also known as TSH or thyrotropin) is a peptide hormone synthesized and secreted by thyrotrope cells in the anterior pituitary gland which regulates the endocrine function of the thyroid gland. TSH levels are tested in the blood of patients suspected of suffering from excess (hyperthyroidism), or deficiency (hypothyroidism) of thyroid hormone.

Anti-TSHB antibody

STJ192321 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to TSHB

Anti-TSHB Antibody

STJ503423 100 µg
EUR 476.00

Anti-TSHB Antibody

STJ503424 100 µg
EUR 476.00

TSHB Antibody, HRP conjugated

1-CSB-PA11769B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TSHB Antibody, FITC conjugated

1-CSB-PA11769C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TSHB Antibody, Biotin conjugated

1-CSB-PA11769D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHB. Recognizes TSHB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal TSHB Antibody (Center)

APR10580G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSHB (Center). This antibody is tested and proven to work in the following applications:

TSHB protein (His tag)

80R-3560 20 ug
EUR 327.00
Description: Purified recombinant TSHB protein (His tag)

Human TSHB ELISA Kit

ELA-E0463h 96 Tests
EUR 824.00

TSHB ELISA KIT|Human

EF000321 96 Tests
EUR 689.00

Rat TSHB shRNA Plasmid

20-abx985197
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human TSHB shRNA Plasmid

20-abx954956
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

TSHB Human Recombinant Protein

PROTP01222 Regular: 10ug
EUR 317.00
Description: TSHB Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 141 amino acids (21-138 a.a) and having a molecular mass of 15.9kDa.

TSHB Recombinant Protein (Rat)

RP234968 100 ug Ask for price

TSHB Recombinant Protein (Human)

RP033139 100 ug Ask for price

TSHB Recombinant Protein (Mouse)

RP181703 100 ug Ask for price

TSHB Recombinant Protein (Mouse)

RP181706 100 ug Ask for price

TSHB Recombinant Protein (Mouse)

RP181709 100 ug Ask for price

Mouse TSHB ELISA Kit

STJ150033 1 kit
EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in Mouse serum, plasma and other biological fluids

Rat TSHB ELISA Kit

STJ150193 1 kit
EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in Rat serum, plasma and other biological fluids

Human TSHB ELISA Kit

STJ150216 1 kit
EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TSH in human serum, plasma and other biological fluids

Anti-TSHB Antibody (Biotin)

STJ503425 100 µg
EUR 586.00

Anti-TSHB Antibody (FITC)

STJ503426 100 µg
EUR 586.00

Anti-TSHB Antibody (Biotin)

STJ503427 100 µg
EUR 586.00

Anti-TSHB Antibody (FITC)

STJ503428 100 µg
EUR 586.00

Human Thyrotropin subunit beta (TSHB)

1-CSB-EP025130HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 28.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Thyrotropin subunit beta(TSHB) expressed in E.coli

Rat Thyrotropin subunit beta (Tshb)

1-CSB-EP025130RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 19.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in E.coli

Monoclonal TSHB Antibody, Clone: 1D12G1

APR10579G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human TSHB. The antibodies are raised in Mouse and are from clone 1D12G1. This antibody is applicable in WB and IHC, FC, ICC, E

Rat Thyrotropin subunit beta (Tshb)

1-CSB-YP025130RA
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 16.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in Yeast

Thyrotropin Subunit Beta (TSHB) Antibody

20-abx005202
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody

abx224242-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHb) Antibody

20-abx103378
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.

Thyrotropin Subunit Beta (TSHB) Antibody

abx034029-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody

abx034029-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Protein

20-abx263265
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody

20-abx306505
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Rat Thyrotropin subunit beta (Tshb)

1-CSB-BP025130RA
  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 16.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Thyrotropin subunit beta(Tshb) expressed in Baculovirus

TSHB Polyclonal Antibody, HRP Conjugated

A50685 100 µg
EUR 570.55
Description: The best epigenetics products

TSHB Polyclonal Antibody, FITC Conjugated

A50686 100 µg
EUR 570.55
Description: kits suitable for this type of research

TSHB Polyclonal Antibody, Biotin Conjugated

A50687 100 µg
EUR 570.55
Description: fast delivery possible

Tshb ORF Vector (Rat) (pORF)

ORF078324 1.0 ug DNA
EUR 506.00

TSHB ORF Vector (Human) (pORF)

ORF011047 1.0 ug DNA
EUR 95.00

Tshb ORF Vector (Mouse) (pORF)

ORF060569 1.0 ug DNA
EUR 506.00

Tshb ORF Vector (Mouse) (pORF)

ORF060570 1.0 ug DNA
EUR 506.00

Tshb ORF Vector (Mouse) (pORF)

ORF060571 1.0 ug DNA
EUR 506.00

Thyroid Stimulating Hormone Beta (TSHb) Antibody

20-abx103377
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody

20-abx104915
  • EUR 328.00
  • EUR 133.00
  • EUR 913.00
  • EUR 467.00
  • EUR 286.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody

20-abx174792
  • EUR 342.00
  • EUR 871.00
  • EUR 453.00
  • EUR 154.00
  • EUR 272.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody

abx239835-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Thyrotropin Subunit Beta (TSHB) Antibody (HRP)

20-abx306506
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody (FITC)

20-abx306507
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Thyrotropin Subunit Beta (TSHB) Antibody (Biotin)

20-abx306508
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Tshb sgRNA CRISPR Lentivector set (Rat)

K6928201 3 x 1.0 ug
EUR 339.00

Tshb sgRNA CRISPR Lentivector set (Mouse)

K4334201 3 x 1.0 ug
EUR 339.00

TSHB sgRNA CRISPR Lentivector set (Human)

K2539501 3 x 1.0 ug
EUR 339.00

Recombinant Thyroid Stimulating Hormone Beta (TSHb)

4-RPD213Ca01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P54828
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Thyroid Stimulating Hormone Beta expressed in: E.coli

Recombinant Thyroid Stimulating Hormone Beta (TSHb)

4-RPD213Ga01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Chicken Thyroid Stimulating Hormone Beta expressed in: E.coli

Recombinant Thyroid Stimulating Hormone Beta (TSHb)

4-RPD213Mu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P12656
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Thyroid Stimulating Hormone Beta expressed in: E.coli

Recombinant Thyroid Stimulating Hormone Beta (TSHb)

4-RPD213Ra01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P04652
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.6kDa
  • Isoelectric Point: 7.5
Description: Recombinant Rat Thyroid Stimulating Hormone Beta expressed in: E.coli

Chicken TSHB/ Thyrotropin subunit beta ELISA Kit

E0085Ch 1 Kit
EUR 494.00

Dog TSHB/ Thyrotropin subunit beta ELISA Kit

E0106Do 1 Kit
EUR 494.00

Rat Thyrotropin subunit β(TSHB) ELISA kit

E02T0738-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thyrotropin subunit β(TSHB) ELISA kit

E02T0738-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thyrotropin subunit β(TSHB) ELISA kit

E02T0738-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thyrotropin subunit β(TSHB) ELISA kit

E04T0738-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thyrotropin subunit β(TSHB) ELISA kit

E04T0738-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thyrotropin subunit β(TSHB) ELISA kit

E04T0738-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyrotropin subunit β(TSHB) ELISA kit

E01T0738-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyrotropin subunit β(TSHB) ELISA kit

E01T0738-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyrotropin subunit β(TSHB) ELISA kit

E01T0738-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine TSHB/ Thyrotropin subunit beta ELISA Kit

E0277Bo 1 Kit
EUR 494.00

Mouse Thyrotropin subunit β(TSHB) ELISA kit

E03T0738-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Thyrotropin subunit β(TSHB) ELISA kit

E03T0738-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Thyrotropin subunit β(TSHB) ELISA kit

E03T0738-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thyroid Stimulating Hormone Beta (TSHb) Protein

20-abx166338
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Mouse Thyroid Stimulating Hormone Beta (TSHb) Protein

20-abx069310
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Mouse Thyrotropin subunit beta (TSHB) ELISA Kit

abx254595-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Rat Thyrotropin subunit beta (TSHB) ELISA Kit

abx255652-96tests 96 tests
EUR 637.00
  • Shipped within 5-12 working days.

Human Thyrotropin subunit beta (TSHB) ELISA Kit

abx253456-96tests 96 tests
EUR 637.00
  • Shipped within 5-12 working days.

Dog Thyrotropin subunit β(TSHB) ELISA kit

E08T0738-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thyrotropin subunit β(TSHB) ELISA kit

E08T0738-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thyrotropin subunit β(TSHB) ELISA kit

E08T0738-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thyrotropin subunit β(TSHB) ELISA kit

E07T0738-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thyrotropin subunit β(TSHB) ELISA kit

E07T0738-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thyrotropin subunit β(TSHB) ELISA kit

E07T0738-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thyrotropin subunit β(TSHB) ELISA kit

E09T0738-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thyrotropin subunit β(TSHB) ELISA kit

E09T0738-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thyrotropin subunit β(TSHB) ELISA kit

E09T0738-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thyrotropin subunit β(TSHB) ELISA kit

E06T0738-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thyrotropin subunit β(TSHB) ELISA kit

E06T0738-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thyrotropin subunit β(TSHB) ELISA kit

E06T0738-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tshb/ Thyrotropin subunit beta ELISA Kit

E1012Ra 1 Kit
EUR 485.00

Mouse Tshb/ Thyrotropin subunit beta ELISA Kit

E1534Mo 1 Kit
EUR 485.00

Human TSHB/ Thyrotropin subunit beta ELISA Kit

E2599Hu 1 Kit
EUR 485.00

Thyroid Stimulating Hormone Beta (TSHb) Antibody (Biotin)

20-abx271722
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody (Biotin)

20-abx272898
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Chicken Thyroid Stimulating Hormone Beta (TSHb) Protein

20-abx652214
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.

Cow Thyrotropin subunit beta (TSHB) ELISA Kit

abx513012-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Chicken Thyrotropin subunit beta (TSHB) ELISA Kit

abx513013-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Dog Thyrotropin subunit beta (TSHB) ELISA Kit

abx513014-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mouse Thyrotropin subunit beta (TSHB) ELISA Kit

abx513016-96tests 96 tests
EUR 637.00
  • Shipped within 5-12 working days.

Pig Thyrotropin subunit beta (TSHB) ELISA Kit

abx513017-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Thyroid Stimulating Hormone Beta (TSHb) Antibody (FITC)

20-abx273890
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Rat Tshb(Thyrotropin subunit beta) ELISA Kit

ER0078 96T
EUR 567.60
  • Detection range: 0.156-10uIU/ml
  • Uniprot ID: P04652
  • Alias: Tshb(Thyrotropin subunit beta)/Thyrotropin beta/thyroid stimulating hormone, beta/thyroid-stimulating hormone subunit beta/thyrotropin beta chain/thyrotropin beta subunit/TSH-B/TSH-BETA
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.094uIU/ml

Tshb sgRNA CRISPR Lentivector (Rat) (Target 1)

K6928202 1.0 ug DNA
EUR 154.00

Tshb sgRNA CRISPR Lentivector (Rat) (Target 2)

K6928203 1.0 ug DNA
EUR 154.00

Tshb sgRNA CRISPR Lentivector (Rat) (Target 3)

K6928204 1.0 ug DNA
EUR 154.00

Tshb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4334202 1.0 ug DNA
EUR 154.00

Tshb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4334203 1.0 ug DNA
EUR 154.00

Tshb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4334204 1.0 ug DNA
EUR 154.00

TSHB sgRNA CRISPR Lentivector (Human) (Target 1)

K2539502 1.0 ug DNA
EUR 154.00

TSHB sgRNA CRISPR Lentivector (Human) (Target 2)

K2539503 1.0 ug DNA
EUR 154.00

TSHB sgRNA CRISPR Lentivector (Human) (Target 3)

K2539504 1.0 ug DNA
EUR 154.00

TSHB Protein Vector (Rat) (pPB-C-His)

PV313294 500 ng
EUR 603.00

TSHB Protein Vector (Rat) (pPB-N-His)

PV313295 500 ng
EUR 603.00

TSHB Protein Vector (Rat) (pPM-C-HA)

PV313296 500 ng
EUR 603.00

TSHB Protein Vector (Rat) (pPM-C-His)

PV313297 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPB-C-His)

PV242274 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPB-N-His)

PV242275 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-HA)

PV242276 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-His)

PV242277 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPB-C-His)

PV242278 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPB-N-His)

PV242279 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-HA)

PV242280 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-His)

PV242281 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPB-C-His)

PV242282 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPB-N-His)

PV242283 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-HA)

PV242284 500 ng
EUR 603.00

TSHB Protein Vector (Mouse) (pPM-C-His)

PV242285 500 ng
EUR 603.00

TSHB Protein Vector (Human) (pPB-C-His)

PV044185 500 ng
EUR 329.00

TSHB Protein Vector (Human) (pPB-N-His)

PV044186 500 ng
EUR 329.00

TSHB Protein Vector (Human) (pPM-C-HA)

PV044187 500 ng
EUR 329.00

TSHB Protein Vector (Human) (pPM-C-His)

PV044188 500 ng
EUR 329.00

Tshb 3'UTR Luciferase Stable Cell Line

TU121225 1.0 ml Ask for price

TSHB 3'UTR GFP Stable Cell Line

TU077294 1.0 ml
EUR 1521.00

Tshb 3'UTR GFP Stable Cell Line

TU171225 1.0 ml Ask for price

Tshb 3'UTR Luciferase Stable Cell Line

TU222542 1.0 ml Ask for price

TSHB 3'UTR Luciferase Stable Cell Line

TU027294 1.0 ml
EUR 1521.00

Tshb 3'UTR GFP Stable Cell Line

TU272542 1.0 ml Ask for price

Guinea pig Thyrotropin subunit β(TSHB) ELISA kit

E05T0738-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Thyrotropin subunit β(TSHB) ELISA kit

E05T0738-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Thyrotropin subunit β(TSHB) ELISA kit

E05T0738-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thyrotropin subunit β(TSHB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TSHB Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV678853 1.0 ug DNA
EUR 514.00

TSHB Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV678857 1.0 ug DNA
EUR 514.00

TSHB Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV678858 1.0 ug DNA
EUR 514.00

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Dog)

4-PAD213Ca01
  • EUR 268.00
  • EUR 2840.00
  • EUR 700.00
  • EUR 340.00
  • EUR 223.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: TSHb (Ser20~Ile138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Thyroid Stimulating Hormone Beta (TSHb)

Thyroid Stimulating Hormone Beta (TSHb) Polyclonal Antibody (Mouse)

4-PAD213Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: TSHb (Phe21~Val138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Stimulating Hormone Beta (TSHb)

Thyroid Stimulating Hormone Beta (TSHb) Monoclonal Antibody (Mouse)

4-MAD213Mu21
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rat monoclonal antibody against Mouse Thyroid Stimulating Hormone Beta (TSHb)